Welcoming you for any type of article submission for the upcoming issue on/before February 26, 2021.


Short Communication
Volume 2 Issue 1 - 2016
ASTERIAS Rubens: Evidence of Immune Genes
Michel Leclerc1*, Nicolas Kresdorn2 and Ralf Horres2
1556 rue Isabelle Romee, 45640 Sandillon, France
2GenXPro, Frankfurt, Germany
*Corresponding Author: Michel Leclerc, 556 rue Isabelle Romee, 45640 Sandillon, France.
Received: February 04, 2016; Published: February 08, 2016
Citation: Michel Leclerc., et al. “ASTERIAS Rubens: Evidence of Immune Genes”. EC Bacteriology and Virology Research 2.1 (2016): 37-42.
Abstract
In recent papers, we have found that the Asterias Rubens genome shown IgKappa genes. It is discovered that the Ig Kappa chain V-IV region S107 B precursor gene was present in non-immunized sea stars. On the other hand, the NF-kappa B gene, into 2 subunits, was shown in these invertebrates.
Keywords: ASTERIAS Rubens; Immune Genes; NF-Kappa; BLASTX
Introduction
In recent papers, we have found that the Asterias rubens sea star genome, shown Igkappa genes [1,2] We try, in the present study, to determine the existence of Igkappa gene in non-immunized Asterias rubens. On the other hand, we attempted to study the NF-Kappa B gene, in the immunized and non-immunized sea star genome. The NF-kappa-B factor was implicated in the immune response in mammals [3]. We discovered the interleukin17 receptor B in sea star genome [4] and we recall that interleukin 17 receptor B mediated the activation of NF-Kappa B in mammals [3]. So it seemed really interesting to study the NF-Kappa B genes in an Invertebrate.
Material and Methods
Immunized and non-immunized sea stars to HRP (Horse-radish peroxydase) were used [1]. The sea star axial organs were removed. RNA was extracted using Trizol (Invitrogen) according to manufacturer instructions. CDNA was normalized using double strand specific nuclease essentially as described by Zhulidov., et al. [5]. cDNA was fragmented using DNA fragmentase (New England Biolabs), according to the manufacturer’s instructions. After ligation of adapters for Illumina’s GSII sequencing system, the cDNA was sequenced on the Illumina GSII platform sequencing 1.100 bp from one side of the approximately 200 bp fragments. Sequences were assembled using Velvet: Zerbino., et al. [6]. Assembled nodes were used for further assembled including Beta vulgaris EST-Data from NCBI in MIRA.
Results
Results are summarized in two parts:
A. Controls
B. HRP
Controls
The first contig shows the presence, in non-immunized Asterias rubens of the gene:
Igkappa chain One contig (Contig3053|m.6472) could be annotated via BLASTX to mouse “Ig kappa chain V-IV region S107B” from the SWISSPROT database, with an e-value of 0,004. On an aligned region of 50 amino acids, 23 positive and 16 identical amino acids were found.
5’:GTTGATCATAAGATCAGAGAATATAAAGTGCGCTCAGTCCTGAAAACAGTTTGTCACAAA CTATTTTTCTTCATACAAATTTATTAGTGTGCTCCTGCAAAACGGCTGATAACTAAAACC AGTATGGCTCTCTTTCTCCGGGTTACGGTGATGGTCCTGGCTGTGATTGGGCTGACCAGG GCTGGATGTCCACCGCTATGGACTGAATATCGTAACAACTGCTACCGTTTAATGGGTCAT GAAAAGTCGTGGACCGATGCCGAAAACCACTGCCGGCAGTTCTTTACCATCAGCGGACAG GGTCATCTTGCATCCGTGCACAGCTCTGACGAAGCGGATTTCCTGCTCCAGTATTCGACA TCTTCATTGACCTCTGCCTTGGACAAACAAGTTTGGCTTGGGATGTCCGACCAATCAAAT GAAGGCACTTTCAGCTGGAGTGACGGCACAGCGTTCGACTACGAGGAATGGCTTCCTGGA CAACCGGATAATGCAGGCTCAAATGAAGATTGCGGTGAAATTAAGTTTCTTGGGGTGCCC CATCGAATGGGCTGGAATGATGGCCGCTGCTCCGATCACCAATCACACGTCTGCAAGATG CCAATGCCAACTGTTCTTTGAATACAAACCGATGAAAGCAAACATGCAGCCTCCATAACA TTTCATCTAGAGAAAACAAAAATCACTTATTCGCCGGGGACATGACTGAATTCAGAGTTG TACAAAGTTGATTTCAGCTCTACCCAGAATGGTTATTGAATCGTCCCACAAATTCAATGA GCCGAAGCATTGATCAACTCAACAAAGTAACTCATCCACAACAGTAACTCAATAGAGTCA CTCAAAACAGTTAATCGTCAGTGTCACCCACAACAGTTTCTCGCCAGAGTCACTCACAAC AGTCACTCGCCAGAGTCACTTACAACAGTTACTCACCAGAGTCACCTGGCACCCACAACA GTTACTCGTCAGAGTCACTCACAACAATTACTCATCGGAGTCACTCACAACAGTTACTCG CCAGACTTAATCATAACAGTTACTCGCCAGAGTCACTCACAACAGTTACTCGCCAGACTT AATCACAACAGTTTCTCACCAGAGTCACTCAATTGCATTACAAAGAATTTTTTCCGATTT TGAATAATTATGGCTAATATTACTCAGAGCACTATGCATTAAAAACATAGAGGCTAAAAT GTCGATTATTTGGACAACAAAAATGCTTGCAATTTTAATCATTATTTTGCTTTTTAGTTT TTAGCTGAGCCAACCATTGTTTTCGAAGAGTTAGACTAGTTTAAATCTTTAACTTTGAAT AATTTTGTATATAAAAGCACACCATACAATTTACATGCAAACGACAATTTAATGCTTAGT CATCGAATTCGGAAGGTAACTATTTAGAGAAATTTTCACCATTAACAGAAATTTAGTTTT GAGGGGATTTTATCAAATCGACATTGATCAATCGATTGTTAAGGCAAAGTTTGGGTTTAT GGAACCATATTTCCATCGTTTAATTTAATAATGTAATTAAATACAATACCACTAAATTAT GTCCCATTTGCCACCTTTTATGCCAGATGACTTTTCTATACAATTAAAGCCATTGGACAC TTTCGGTAAACAGTATTGTCCAAAGGCCCAAACTTTGTGTATCACAACTTATATATACAA TAACAACCTGTGAAAAATTAGGCTCAATCAGTCATTGGAGTCAGGAGAAAATAACGGGAA AACCCACTCCTGTTTTCGCGCGTTTCGC 3’
The second contig, with its sequence, indicates the presence of « Nuclear factor NF-kappa-B p100 in « Controls »:
One contig (Contig12117|m.10680) could be annotated via BLASTX to mouse “Nuclear factor NF-kappa-B p100 subunit” from the SWISSPROT database, with an e-value of 7,00E-071. On an aligned region of 242 amino acids, 170 positive and 138 identical amino acids were found.
5’:AGAAGATTGAAAACCGGAAGAATTGTGACACTGCAACTTGTCACACTTGAAGCACCAATT TAAAAGATGTCAGACGAGGAGAGGTCTGATTCCCTGCAGTCAGTTGAGATCCCAAATGAC ATGTTACAGCAAGCATTCTTAAACAATAACGGAGCATCAAACCAATCCTCGGAAATGAAT TTATCTGTTCTGCCAACTGACCTTCATCAACTTGAGGTCATGACAGGAATGAGTCAACAG ACGCTAAATGACCTCTCTGCTCCCAAACTCCGCATCATAGAGCAACCCAAACAGCGTGGC TTTCGGTTCCGTTACGACTGCGAAGGGCCATCACATGGTGGTCTCCCGGGTCAACATAGC CAGAGAGGAAAGAAGACCTTCCCATCAGTTGAGATACTTAACTATACTGGACCAGCAAGA ATTGTTGTTTCCTTGGTAACCAGTGAAGATCTACCTAAACCCCATGCACATAGCATCGTT GGCAAACACTGCACTGATGGATCATGCACTGTGCAGGTCGGACCTACAGACATGACTGCA AGCTTTCCAAACCTTGGCATCCTTCATGTAACTCGCAAGAATGTTGAGAGGGTCTTGAAA GATCGTCTTCGTGAACAGCAGAAGCTTTATAGGACTTTTCTTGGTGATAAGGGATTCGTA CCTGGAGCACAGCATCTGCTTGAGACTGAGCCAGCCCTTGCCAAGAAAGCCAAGGAAATG GCCAAGGAGATGGATCTGTCTAAGGTGTGCTTGTGTTTTCAAGCCTACCTTCCAGACAGT CAGGGACATTACACGCGTCCTCTGGCTCCTGTCACATCACTACCCATCTTTGACAGCAAG GCCCCTGGTGCAACAACTTTAAAAATCTGCCGTATGGACAAGAGCTCAGGATGTGTGACA GGGAATGACGAGGTATATCTGCTTTGTGATAAAGTTCAAAAGGACGACATTTATGTGAGG TTTTTTGAGATGAACCCAAGCGGAAGTGGGCC 3’
The third contig with its sequence reveals the presence of another subunit of NF Kappa-B (p105):
One contig (Contig675|m.5295) could be annotated via BLASTX to mouse “Nuclear factor NF-kappa-B p105 subunit” from the SWISSPROT database, with an e-value of 4,00E-071. On an aligned region of 518 amino acids, 263 positive and 192 identical amino acids were found.
5’:CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAACAGCAAAAT CACCAGGGTGCGGGCTTCCAGAGCCGTGGTATAAGCTTTGAAAAGGATCAAGACTTGAAG ATTACCCGCGAGACTGAAGTGGTGCAGGACACACAACCAGCGGTTCTACCTACAGTCACT CTTATTGGGGAGAGAGAGATTGATAGCGATCTTGAAGTAGATTCTCAAATACTTGAGGAT GCAACAAAAGGCCCTGTCAGGCGATTTGAATCCTGTGTGCAGAGTGGAGTTGGAGTTAGC ACTTTTGAACCAGCAAAAAGTGCCAGAGATATTTCTGTGCAGACTGATGATATTCCATTG GATTATGAATCCCTCGCTTGGCGTCTTGCTGAGCGTACATCTCGTGCATTGCGTGACTTT GCAATCACTGCTGATATGAAGATGCTGTTAGCGGTCCAGAGGCACCTGACTGCTGTGGAG GATGAGAATGGTGACACACCTCTTCATCTGGCAATTATCCACAAGAAATACGACGTTGCT TTGGGACTCTTAAATGTCATTATCAGCATTCCTCATCAGAAGATCATTAATCATCACAAC AAACTTCATCAGACGCCCCTGCATGTTGCTGTAATCACAGAACAGCCTGACATTGTAGAG TTACTTCTCCGTTGTGGAGCTGATCCAAACATCATGGATCATAACGGGAGTATGCCTATC CACCTAGCTGCTCATAATCGTCTTAGTGATATAACAGAGGTCTTAGTCCAAGGGGTGGAA CCACTTCCTGGAAAGTCCAACGCTTCTATTGATCCAATCCCTACTGAAATCAACCTCAAG AATCTTGATGGCTTCACTGCAGCACACATTTCAGTTCAGATCTCTGATTTGAAGAACCTC AAAGTTTTGGTGAAAAACGGAGCTGATATTAATGTTCAGGATGGTAAAAGTGGTCGCACC ACCCTCCATTACGCCGTGGAGCAGGCAAACTTCTCACTGCTTGGATACCTGATTGCTGAT GCAGATGCAGATATCCACATTCAGACGTTTGCTGGTGATACCCCACTTCATCTTGCTTGC AGCCTTGATTACGTTGCTGTTGCTGCAGTTCTGGTTAGTGCTGGAGCAGAACCAAGCATT GAGAACTTTGACACCTCTTCCAACGAGATGGCTGGGGAGACTGGTGTAATATCTGATGAA GGACATGTGGAGATATTTGAAGACGAGTACAATAATGAGATACTTAGTGGCAAGACATCA GTGGATCTGGCATGCTCTGAGAGGATGTTGAAAATTTTGAATGGTGAGGACTACATATCC AGTTCAGTGTCAGAATCCACACCTAGATTTGAAGAGAGTTTGGTATCAGCTGTTTCTGGT TCCTACGCCTCTAAGACCAATATGTCTGATTCCTACACCTCTACTGCAAATAAATCAAGC ACTAGCCTCCGCTTCACTCCCACAGGAGATTTGAATCGCCTGGATTCCTTAACTCGTCAG AAATTATCGTCGCTCCTGGATGAGATAAAACCCCACAGGGATTGGTTGTCTCTTGCAGAC CACTTGGGCCTTGGCAACATGATTAACCAATTAAAGCAGTTTGATAGCCCCACAAGTATA CTGCTTGACCAGTATGAGGCCATGGATGGAACTATCACGGAGCTCACCTCAGTTCTCAAA GGTCTAAATCGTGAAGACGCTATTAACGTCATTGCAGAAATAAGGAAGCCAATGAAAAAA GCTGCTCATCCCTTACCCAAAGATTTGGATTGTACAACTCAAAACGATTCCGGTCTGGCA TCCTCCCTTCAATCCATGCAGATTACAGGAGATTCTGGTTTGTCCCGTGGATGTATGACG AATCAGTTCAACCAGTCGGATGCCAGGAATATTGAAGTTTAGCTATTTTGGTGTTAAGAA ATAAATTTGATGCAAAAATAGGTGGTGTTTTGTTTCCCCAAAAGACTGTATAGTTGTACA TAGTGCTTCGTAAATGCCTTGTGAAGTTTATTAAAGTGAGATATTCTACTTTGTATTATC GGTTTAAATCTTAAGGTATTATGTAGTTGAAGAACTTGAAACGTCTTAATTTCTAACTAG GTGTTTAAGATAACTGTTTTTGTTATCAGAAAATAACTGTGGGAAACATAGCAAAACGCT GGAAGATTAGAATGATTTTTGGGAATATTTTCCTTGTGTAATAGGTTTTTTTTCTTTTTC TGAAGATACATTTTTTACAGAATTTTGTCTGCAACATATATCATACAAATTTTCGGCTTA ACTGTCGTCAGGACATTGTCTGTTATGTTTGTAAATGTAAATGTTTGTCGCTTTATTGTC ATTGCATCAGTGAAACAAAAGGGAGCACTACTTTGTTAGTGCAGGGATCTTTTTATTGTA CCAGCTTTGTAAAGCCTTGTTAGCCATAAAGAAATGTTTCTTAAATACTTGTTTTTCAAT CTATTTGATAGTCGTCAAGAAGGATTTAAACAGAACATATTTTTAGGAACTGCTTGTTTT AATTTTGTGGACAGTTCACTTTAAAGCAGAAACATGGTGATAGTTAGCTCATTGTTAAGT AAAGGAGATGGCTGTGATGGGAATTGCATTGGTGAAAGCATAATAGGCCCAATGCTGTTT ATCAACCTGTTTGTTTTATGAACAATGTGTAGCCTCCAAACACACTCTAGTTTAAATCAT ATTAGTTTGGATTTGTGTACATCACTACCTATGAAAGAGTCTTGGACAAGTTGTGCAAAA TGCTGCATCTTTTGTTTAAGAACATCATTATTGCTTTGTATCACATTACATAGGAGGTGA TTGGTCTCTTGTGTCTCTAGATTGCCAATGTAATGGTGAGATTGACAATGTAATGTCGCA TGAGTTCCAATTTAGCATCCATTGTGGTTCGAATAGATTTTTTTACATTTAAAGGCAGTG GACACTATTGGTAATTGTCAAAGACTAGCATTCACAGTTGGTGTATCTCAACATTTGCAT AAAATAACAACTCAGTAATAATTTCAAATTAAAGATTTATTAAATTTGTATTCAAGTTTG CAAAATGTTACAGACTATTCTTTTACAATAGAAGATTTAAAAGCAATGTTGTGTAATACT ACTGCATTTACCTTCAAAATAAAGAATTTATAATTTAAATTTGCAACCCTCCTACTGTTG GTACAATTATCTAAAAAGTTGATGCACACTATCGTGGCTTCAAATACTAACCAGCTCCCC CCCCCGCCCAGTTTTATAGAGCTCCTTTAGCAGTAAATATTGATATATATTTGGTTTGCA GTAACACCATGTGTGTATCTACTTGCCAGGTAGAGTTTGTTCCTAGAGAACTGTCTTGCT TTATTCAAATACCGCGGAGAAGATGTTCGGGGGATCGGGAGACTTCTCAGTTCAGAAAAG AATTGTCCTGCTTTTTCAACTATTACCTGGGCGGATTGTATAGAACATATGCTGGGACTA CTACTTAAGCTTATAGGATCGTAATTAACTG CAAAGTATAGTACACTACAAATCCAAGATGCACAATTTAGTGACAACGGCAATTACGTCT GCCAAGTAGGCAATAACAGAGCCTATGGTGATCTTACAGTAACGTATGATGGAATCGTCG TAATTAAAGGCAATCGAGTCATTGAAATGGAGCAAGATATGAACTTCACATGCTTTATTG ATGGCGACTCATCTGTTGAGGTCACATGGAAAAAGGAAAATACAATGCTACCATCTCCTG AGCTGCCTAACATTGAAGTAAAGGGAAGCTCTCTGCTTATAAAGAAGGCATCGACTGCCA ATGGTGGTAAATACACCTGCAGTGGATTGTACAACAAAACAATTCCAGTTGAACAAACTA TTTATGTAGGAGGGGAAATGCGAATCAAGTCCCCCAATTCAGTGAAGTTTACAGAAGGAG AGCGTGCTCGCTTTGAGTGTGTCATTCTCCAGCCAGAAGGCGACCCCAAACCTACTTTCC AATGGATAGTGAGCACTGCAAACTACACCTTTGAGCTGACTGAGACGATTGAGGGAAGTC GCTACTCCATTGAGCCGTCCAAGCACAAGACTGGATCCATCTTGCACATGCTGGATGTAG TCAAGGAAGACAGAGGAAACTATACTTGCATTGCAACCAGTAACGT 3’
HRP
2 contigs (a and b) show the presence also of two subunits of Nuclear factor in immunized Asterias Rubens
a)One contig (Contig11285|m.9708) could be annotated via BLASTX to mouse “Nuclear factor NF-kappa-B p100 subunit” from the SWISSPROT database, with an e-value of 1,00E-031 . On an aligned region of 203 amino acids, 107 positive and 78 identical amino acids were found.
5’:GACAAATTCGACACTTACAAAAAGCATCTCAACCCGAGTAGGAAGGAATCTCTTTTAGTT GCAGTAAATTTTGAATTTGTATAATTCAGTATTTTGTGCTCCCTTTGGTATCAGTTTAGA TCCACACAACCTGTGAAAAACTTCAGTACTTACTAGATTTCGCCAACGCAACGGTAAACG AGTCATTTGATTTTGACCATCATCAACTGAAGCAACGCACGTAATACACACAACAAACGG AACATTTTGTGTGTAGTTTCCAGCGATTCGAGAAGCAAATCAAAGACAAGATGTCTTTAC CCAGTGATGTTGAAACAGACTCCGTCATGGATAGTCCAGCAGAGATTCATATGAACATGA ATAAGCTACAATCTAAACTTCCCAGCGTTACTCAAGACGAGAGATTTGACTCCGGAATTG ACTCGTTACGTTCTGTTGATTCGGCGTACTGCTTGAGCTTCGAAAGGGAATCGAGCCTGG CTTCGATAAATGAGAAGACGTCTCTCACATCACACCTGCAACAGCTCCATCTTTCACATG AAACAAGAACAGAAACCGAGAAGACTGAAACGACAGTAGAAGACATCGATGAAGCTTATC ATGATGAGTGTACTATGTCTGAAACACTCGACAATTTGGAAGAAACTGCAAGAATTGTGG AATATCCTGAACAAAGATGCACGGGACGTCTTACAGATGATGCCTTCGACCAAGACCAAG AGGGAGATACGCCCCTTCATCTTGCTATTATTCATAAGGAAGTGGACTTCGCAGAAAAAT TCATCATCTTTGTTGCAGATCCTGAGTTACTGAACATCAGCAATGATCTTATGCAGACTC CTTTACACCTTAGCGTATTAACAAGGCAACAAGATATCTGTCGTGTTCTCGTCTTGGGCA ATGCCCAAATCGACTGCACCGACCGAAACGGCGACACTCCTCTTCATATTGCATGCAGAC TGAGAGATGAGGGCTGTATCAGAGCTCTGACTGAAGGAATATCTCCACTCGAGCGTAAGA GAGGGATGGTTCCACAGAATAGAGCAAGTGGGGTACAACAGCTTCCACAGAATCTTGAAC TCAGAAACTTTGAAGGCTACACATGCATCCATATTGCAGGATTCGCTTGTAGCGTCGATC AGTTGGAGTACCTTGTGCAGCTAGGCGGCGACATAAATGCCCCGGATGGAAAGAGCGGAA GGACCATTCTCCACTACGCTGTAGAGGCGGGTGACTTTTCTCTTTGTCAGTACCTCATTG CGAACTTGGGTGCCAATGTTAATGCGTTGACCTTTGACCAGTGCACACCC 3’
b) One contig (Contig2602|m.5791) could be annotated via BLASTX to mouse “Nuclear factor NF-kappa-B p105 subunit” from the SWISSPROT database, with an e-value of 2,00E-058. On an aligned region of 398 amino acids, 209 positive and 153 identical amino acids were found.
5’:GCTACCCTATGCAGCAAATGTACCAGCAAAGTCCACAATGCCAACACCCAGGCTCTACAG GTTATCCGAACCAACAGCAGTTAACATTGCAGCAGCAGCAGCAGCAGCAGCAACAGCAAA ATCACCAGGGTGCGGGCTTCCAGAGCCGTGGTATAAGCTTTGAAAAGGATCAAGACTTGA AGATTACCCGCGAGACTGAAGTGGTGCAGGACACACAACCAGCGGTTCTACCTACAGTCA CTCTTATTGGGGAGAGAGAGATTGATAGCGATCTTGAAGTAGATTCTCAAATACTTGAGG ATGCAACAAAAGGCCCTGTCAGGCGATTTGAATCCTGTGTGCAGAGTGGAGTTGGAGTTA GCACTTTTGAACTAGCAAAAAGTGCCAGAGATATTTCTGTGCAGACTGATGATATTCCAT TGGATTATGAATCCCTCGCTTGGCGTCTTGCTGAGCGTACATCTCGTGCATTGCGTGACT TTGCAATCACTGCTGATATGAAGATGCTGTTAGCGGTCCAGAGGCACCTGACTGCTGTGG AGGATGAGAATGGTGACACACCTCTTCATCTGGCAATTATCCACAAGAAATACGACGTTG CTTTGGGACTCTTAAATGTCATTATCAGCATTCCTCATCAGAAGATCATTAATCATCACA ACAAACTTCATCAGACGCCCCTGCATGTTGCTGTAATCACAGAACAGCCTGACATTGTAG AGTTACTTCTCCGTTGTGGAGCTGATCCAAACATCATGGATCATAACGGGAGTATGCCTA TCCACCTAGCTGCTCATAATCGTCTTAGTGATATAACAGAGGTCTTAGTCCAAGGGGTGG AACCACTTCCTGGAAAGTCCAACGCTTCTATTGATCCAATCCCTACTGAAATCAACCTCA AGAATCTTGATGGCTTCACTGCAGCACACATTTCAGTTCAGATCTCTGATTTGAAGAACC TCAAAGTTTTGGTGAAAAACGGAGCTGATATTAATGTTCAGGATGGTAAAAGTGGTCGCA CCACCCTCCATTACGCCGTGGAGCAGGCAAACTTCTCACTGCTTGGATACCTGATTGCTG ATGCAGATGCAGATATCCACATTCAGACGTTTGCTGGTGATACCCCACTTCATCTTGCTT GCAGCCTTGATTACGTTGCTGTTGCTGCAGTTCTGGTTAGTGCTGGAGCAGAACCAAGCA TTGAGAACTTTGACACCTCTTCCAACGAGATGGCTGGGGAGACTGGTGTAATATCTGATG AAGGACATGTGGAGATATTTGAAGACGAGTACAATAATGAGATACTTAGTGGCAAGACAT CAGTGGATCTGGCATGCTCTGAGAGGATGTTGAAAATTTTGAATGGTGAGGACTACATAT CCAGTTCAGTGTCAGAATCCACACCTAGATTTGAAGAGAGTTTGGTATCAGCTGTTTCTG GTTCCTACGCCTCTAAGACCAATATGTCTGATTCCTACACCTCTACTGCAAATAAATCAA GCACTAGCCTCCGCTTCACTCCCACAGGAGATTTGAATCGCCTGGATTCCTTAACTCGTC AGAAATTATCGTCGCTCCTGGATGAGATAAAACCCCACAGGGATTGGTTGTCTCTT 3’
Discussion and Conclusion
These results have proven to be of particular importance
First, it is shown that the isolated Igkappa gene [2] with 2 Ig sites exists also in non-immunized animals. Second, it appears that NF Kappa-B factor is present in sea star immune system, under 2 subunits p100 (daltons) and p105 (daltons) : undoubtedly it plays a role in the immune function of Asterias rubens, when compared to mammal’s one [7]. The sea star immune complex appears more and more sophisticated.
Bibliography
  1. Leclerc M., et al. “Evidence of Kappa genes in the sea-star Asterias rubens (Echinoderma)”. Immunology Letters 138.2 (2011): 197-198.
  2. Vincent N., et al. “A new gene in A. rubens: A sea star Ig kappa gene”. Meta gene 4.2 (2014): 320-322.
  3. Hayden MS., et al. “NF-kappaB and the immune response Oncogene”. Oncogene 25.51 (2006): 6758-6780.
  4. Leclerc M., et al. “A true candidate ig kappa gene” in the sea-star: asterias rubens (Echinoderma)”. American Journal of Immunology 9.3 (2013): 75-77.
  5. Zhulidov PA., et al. “Simple cDNA normalization using kamchatka crab duplex-specific nuclease”. Nucleic Acid Research 32.3 (2004): 37.
  6. Zerbino DR., et al. “Velvet: algorithms for de novo short read assembly using de Bruijn graphs”. Genomic Research 18.5 (2007): 821-829.
  7. Scheinman RI., et al. “NF-kappa B p100 (Lyt-10) is a component of H2TF1 and can function as an I kappa B-like molecule”. Molecular and Cellular Biology 13.10 (1993): 6089-6101.
Copyright: © 2016 Michel Leclerc., et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

PubMed Indexed Article

EC Pharmacology and Toxicology
LC-UV-MS and MS/MS Characterize Glutathione Reactivity with Different Isomers (2,2' and 2,4' vs. 4,4') of Methylene Diphenyl-Diisocyanate.

PMID: 31143884 [PubMed]

PMCID: PMC6536005


EC Pharmacology and Toxicology
Alzheimer's Pathogenesis, Metal-Mediated Redox Stress, and Potential Nanotheranostics.

PMID: 31565701 [PubMed]

PMCID: PMC6764777


EC Neurology
Differences in Rate of Cognitive Decline and Caregiver Burden between Alzheimer's Disease and Vascular Dementia: a Retrospective Study.

PMID: 27747317 [PubMed]

PMCID: PMC5065347


EC Pharmacology and Toxicology
Will Blockchain Technology Transform Healthcare and Biomedical Sciences?

PMID: 31460519 [PubMed]

PMCID: PMC6711478


EC Pharmacology and Toxicology
Is it a Prime Time for AI-powered Virtual Drug Screening?

PMID: 30215059 [PubMed]

PMCID: PMC6133253


EC Psychology and Psychiatry
Analysis of Evidence for the Combination of Pro-dopamine Regulator (KB220PAM) and Naltrexone to Prevent Opioid Use Disorder Relapse.

PMID: 30417173 [PubMed]

PMCID: PMC6226033


EC Anaesthesia
Arrest Under Anesthesia - What was the Culprit? A Case Report.

PMID: 30264037 [PubMed]

PMCID: PMC6155992


EC Orthopaedics
Distraction Implantation. A New Technique in Total Joint Arthroplasty and Direct Skeletal Attachment.

PMID: 30198026 [PubMed]

PMCID: PMC6124505


EC Pulmonology and Respiratory Medicine
Prevalence and factors associated with self-reported chronic obstructive pulmonary disease among adults aged 40-79: the National Health and Nutrition Examination Survey (NHANES) 2007-2012.

PMID: 30294723 [PubMed]

PMCID: PMC6169793


EC Dental Science
Important Dental Fiber-Reinforced Composite Molding Compound Breakthroughs

PMID: 29285526 [PubMed]

PMCID: PMC5743211


EC Microbiology
Prevalence of Intestinal Parasites Among HIV Infected and HIV Uninfected Patients Treated at the 1o De Maio Health Centre in Maputo, Mozambique

PMID: 29911204 [PubMed]

PMCID: PMC5999047


EC Microbiology
Macrophages and the Viral Dissemination Super Highway

PMID: 26949751 [PubMed]

PMCID: PMC4774560


EC Microbiology
The Microbiome, Antibiotics, and Health of the Pediatric Population.

PMID: 27390782 [PubMed]

PMCID: PMC4933318


EC Microbiology
Reactive Oxygen Species in HIV Infection

PMID: 28580453 [PubMed]

PMCID: PMC5450819


EC Microbiology
A Review of the CD4 T Cell Contribution to Lung Infection, Inflammation and Repair with a Focus on Wheeze and Asthma in the Pediatric Population

PMID: 26280024 [PubMed]

PMCID: PMC4533840


EC Neurology
Identifying Key Symptoms Differentiating Myalgic Encephalomyelitis and Chronic Fatigue Syndrome from Multiple Sclerosis

PMID: 28066845 [PubMed]

PMCID: PMC5214344


EC Pharmacology and Toxicology
Paradigm Shift is the Normal State of Pharmacology

PMID: 28936490 [PubMed]

PMCID: PMC5604476


EC Neurology
Examining those Meeting IOM Criteria Versus IOM Plus Fibromyalgia

PMID: 28713879 [PubMed]

PMCID: PMC5510658


EC Neurology
Unilateral Frontosphenoid Craniosynostosis: Case Report and a Review of the Literature

PMID: 28133641 [PubMed]

PMCID: PMC5267489


EC Ophthalmology
OCT-Angiography for Non-Invasive Monitoring of Neuronal and Vascular Structure in Mouse Retina: Implication for Characterization of Retinal Neurovascular Coupling

PMID: 29333536 [PubMed]

PMCID: PMC5766278


EC Neurology
Longer Duration of Downslope Treadmill Walking Induces Depression of H-Reflexes Measured during Standing and Walking.

PMID: 31032493 [PubMed]

PMCID: PMC6483108


EC Microbiology
Onchocerciasis in Mozambique: An Unknown Condition for Health Professionals.

PMID: 30957099 [PubMed]

PMCID: PMC6448571


EC Nutrition
Food Insecurity among Households with and without Podoconiosis in East and West Gojjam, Ethiopia.

PMID: 30101228 [PubMed]

PMCID: PMC6086333


EC Ophthalmology
REVIEW. +2 to +3 D. Reading Glasses to Prevent Myopia.

PMID: 31080964 [PubMed]

PMCID: PMC6508883


EC Gynaecology
Biomechanical Mapping of the Female Pelvic Floor: Uterine Prolapse Versus Normal Conditions.

PMID: 31093608 [PubMed]

PMCID: PMC6513001


EC Dental Science
Fiber-Reinforced Composites: A Breakthrough in Practical Clinical Applications with Advanced Wear Resistance for Dental Materials.

PMID: 31552397 [PubMed]

PMCID: PMC6758937


EC Microbiology
Neurocysticercosis in Child Bearing Women: An Overlooked Condition in Mozambique and a Potentially Missed Diagnosis in Women Presenting with Eclampsia.

PMID: 31681909 [PubMed]

PMCID: PMC6824723


EC Microbiology
Molecular Detection of Leptospira spp. in Rodents Trapped in the Mozambique Island City, Nampula Province, Mozambique.

PMID: 31681910 [PubMed]

PMCID: PMC6824726


EC Neurology
Endoplasmic Reticulum-Mitochondrial Cross-Talk in Neurodegenerative and Eye Diseases.

PMID: 31528859 [PubMed]

PMCID: PMC6746603


EC Psychology and Psychiatry
Can Chronic Consumption of Caffeine by Increasing D2/D3 Receptors Offer Benefit to Carriers of the DRD2 A1 Allele in Cocaine Abuse?

PMID: 31276119 [PubMed]

PMCID: PMC6604646


EC Anaesthesia
Real Time Locating Systems and sustainability of Perioperative Efficiency of Anesthesiologists.

PMID: 31406965 [PubMed]

PMCID: PMC6690616


EC Pharmacology and Toxicology
A Pilot STEM Curriculum Designed to Teach High School Students Concepts in Biochemical Engineering and Pharmacology.

PMID: 31517314 [PubMed]

PMCID: PMC6741290


EC Pharmacology and Toxicology
Toxic Mechanisms Underlying Motor Activity Changes Induced by a Mixture of Lead, Arsenic and Manganese.

PMID: 31633124 [PubMed]

PMCID: PMC6800226


EC Neurology
Research Volunteers' Attitudes Toward Chronic Fatigue Syndrome and Myalgic Encephalomyelitis.

PMID: 29662969 [PubMed]

PMCID: PMC5898812


EC Pharmacology and Toxicology
Hyperbaric Oxygen Therapy for Alzheimer's Disease.

PMID: 30215058 [PubMed]

PMCID: PMC6133268


News and Events

June Issue Release

We always feel pleasure to share our updates with you all. Here, notifying you that we have successfully released the June issue of respective journals and the latest articles can be viewed on the current issue pages.

Submission Deadline for Upcoming Issue

ECronicon delightfully welcomes all the authors around the globe for effective collaboration with an article submission for the upcoming issue of respective journals. Submissions are accepted on/before July 05, 2022.

Certificate of Publication

ECronicon honors with a "Publication Certificate" to the corresponding author by including the names of co-authors as a token of appreciation for publishing the work with our respective journals.

Best Article of the Issue

Editors of respective journals will always be very much interested in electing one Best Article after each issue release. The authors of the selected article will be honored with a "Best Article of the Issue" certificate.

Certifying for Review

ECronicon certifies the Editors for their first review done towards the assigned article of the respective journals.

Latest Articles

The latest articles will be updated immediately on the articles in press page of the respective journals.