Welcoming you for any type of article submission for the upcoming issue on/before February 26, 2021.


Research Article
Volume 2 Issue 4 - 2016
Other Irf Genes in the Sea Star Asterias Rubens
Michel Leclerc1* and Nicolas Kresdorn2
1Orleans Cell Biology, Developmental Biology and Immunology, University of Orleans, France
2Department Plant Breeding and Genetics, : GenXpro, Frankfurt, Germany
*Corresponding Author: Michel Leclerc, Orleans Cell Biology, Developmental Biology and Immunology, University of Orleans, France.
Received: May 09, 2016; Published: May 20, 2016
Citation: Michel Leclerc and Nicolas Kresdorn. “Other Irf Genes in the Sea Star Asterias Rubens”. EC Bacteriology and Virology Research 2.4 (2016): 151-153.
Abstract
IRF4, IRF2 and IRF8 genes have been recently discovered in the sea star A Rubens. Emergence of other IRF: IFIH1, IFRD1 and I2BPL genes occur in this invertebrate.
Keywords: Irf Genes; IRF4; IRF2; IRF8; Sea Star Asterias
Introduction
In mammals, interferon regulatory factors (IRFs) play a fundamental role in both the innate and adaptative immunity [1]. IRF2, IRF4 and IRF8 have been recently shown in the sea star Asterias rubens which is the only invertebrate to possess these factors (in press). Other IRFs found exclusively, in this invertebrate are now described such as: IFIH1, IFRD1 and I2BPL genes.
Materials and Methods
Sea stars were obtained from the Biology Institute (Gothenburgh University). Immunizations, genomic studies were already described [2]. After ligation of adapters for Illumina’s GSII sequencing system, the cDNA was sequenced in the Illumina GSII platform sequencing. 1.100 bp from one side of the approximately 200 bp fragments sequences were assembled using Velvet [3].
Results
First result concern IFIH1 gene: One Contig (Contig 11382) could be annotated via BLASTX to MUS musculus “Interferon-induced helicase C domain-containing protein 1” (IFIH1-MOUSE), with an e-value of 3.1e-32. On an aligned region of 427 amino acids, 200 positive and 122 identical amino acids were found. > Contig 11382.
5’CCAGGAGGTACCAGTCACAAATCTGGTTTTAGAACTCATCTTCGTCCTGCAGAAGTACAA AGCCAGCTTTCTTCCACTGCTTCGGAACCTTTGCAGTTCCTTCGCGAGAGAAGACAATCT TGAAGCTGTCTGCTTTCAGTGCGTATCCGAGAGGGGGGTCTAGCAACAGGAACTTCTGCA TTGTTCCAAGATTTTTCTTGCAGGTGTAAGTGGCACATTTGATGAGACCAGTTGTTTCTG TGTCTCGATATCGCTGTGGTCTGCTATACTGTATCTCTGTAATCTTGCTACCAAAGTCCG GACTGATGCAAGTCACATGACCAGCAGTTCCTTTCCGTCGCAGCTCTGACGCTTTGCAAA TGTAGGCGGAGCATTCTTTACAATGAATGTGGATCTTCTCAAGATCGTGCATACTGCCTT GGAGCTTTTCCTGCTCCTCAGCTTTGATTATTGCTTTTATTCGTGCGTCCTGTTTTTCCT GGATCTTGACAAGCCGATCCTCTTCCACCATGGCTTCCAGCTCCTCCATTGCTTTCTCCA TTCTGACCACCTTTGAGCGATTCTCATACTCTCTCTTTTCATTTTGGGAATTTCTTTCCA CGATGAGGAAGCACTGGCTCCCACTTGCACGTGCTCGTCCCTTCGACTGGACCGTGCCGA TCTCATTACTGACGAAGTTATACCTGATGACAAAGCTACAGGCTGGCATGTCAAGGCCTT CCTGAGCGATATCTGTAGCCACTAAGATGTTACAGCCATCATCTTTTCTGAAACTGTTCA GAACCTCCTTCTGTTGAGCCTCTGTCAGGCAGTCATCTTCTAGGCTGCCCTGCCCAACCA GCCTGAGTGGTTCGATCCTGCATGGTAAGGACTTCAGGAGATTTGAAGACCTCAGAAACT CAACCAGAGCGGTGGCAGCTACTTTCATGGTTGCGAGAATAATTCCTTTAGATTCAGGTT TATCCGAGAAGATCTCATGTAGAACATGAGCAAGTTCCCCAAGCTTGTGGTTGCTATGCT GCCCTTCGTCCTTCTCCAGTTCCTTCATTCGAGGAAGTTGTGAGTTGAAGAGGCGCCGGC AGTGTTCCTCAACTGGTACCTGGTCTGGATGATCGTGAACATATCGACTGACATGAAACT CCTCCAAGTGTCGAACTCCATCCTTGACCCTTAGATCATCGTAGAGAATCATGGCACGAT TGTACTCGTATAAGTACATGTAGACAATGATATCCGTGCGATTGGCCGATCTCTG 3’
Second result concern IFRD1 gene: One Contig (Contig 4733) could be annotated via BLASTX to Mus musculus “Interferon-related developmental regulator 1” (IFRD1-MOUSE), with an e-value of 2.6e-27. On an aligned region of 124 amino acids, 91 positive and 69 identical amino acids were found.
5’CTAGAATCTCTGGCCCAAACTTGATAATCTCATGCGGGATGTCGTTTTCCTCAATCGTTC TGATGATATCTCTGAAGCTAGACCGTTGCTGACGTCTGTCTTTCTTAGCTCTGTATTTAT TGCTGTCTGTTGCTAAGCCTCGTAGACTAACCAATAACTCCTCAACATTCTCCATGTCAA AGTCTTCATTCTGCTCCCTGGCTAACTCATAAAGCATAGCAATGGACTCTCCCGCCTCGA TCCTCAGGCTGACATCATCGCTGTGTAGGAGACTAGGAAGTTTACTTAAATGGCTATCCA CAAGTTTTGAAACACGGGATGGTGGTGTGATAGATAGTAACAGGGTCCATGCAGACAGTG CCGCGCAATGCAGCGCCGAGACGGCTGGGTTGTGCGAGGGCGCTGTGCCATCT 3’
Third result concern IFR gene: I2BPL One Contig (Contig 3305) could be annotated via BLASTX to Mus musculus “Interferon regulatory factor 2-binding protein-like” (I2BPL-MOUSE), with an e-value of 3.3e-71. On an aligned region of 370 amino acids, 224 positive and 190 identical amino acids were found. >Contig 3305.
5’AAAGTGTGTGTCCTCTAAACGCTCGTGGCAAATGGTACACTTGAGTGTACTTATGGGTAC AGAAGAGTCCGGGAGGTGACTTGTGTTTGAACTGATGCTGGTTTCAATGGGGTGTCCCTG GGACTGGGCAAGCTCTCTGCTTCGGTACAGAGCTCGGCGCTGAGCTTGAGTTGGGGAGTG GGGACTCCGCTGAGTTTTGTCCGAAGATGTCCCGTTGTTGCTGGGGTTGCTAACCAGATT GGGCATGGAGTTGTCTGGCTTGTTTGGCGAAGTGGGGGTGCCGAGGTTGTCAGTGACTGA CATGAGGGCGGCCATGGGTGAGGGGCCTCCCTGTGTGGAGCTACCCGTCTCCGGTGGAGT GCTCGATGTCGGATTGCTCAGAGGAGAGCCACCCGAGCTGGGAGGCCTGGAGCTAGAATT AAATCCAGTCGAGGCGATGGTGTGTTTCAATCCCTCACTCTGGTTCTGCAACCACTGTTG TCTCTGCTGTTGCACCTGTTCGTCCGTCAACTTTCCGGGAACTTCGGGGTCAGGTTCGGG GGATGCCTTGCGTTTCTTGGACTTGTGCGGCATGCCCGCCATCATCTGATTGGCTATGAT GGTTGGCAAAACGGGACAGCTCGCGTCAATGTACGGCTGTGGCAACATATCTACGCTGAC AACTTCTTTGAAGAATCGTACAGCTTCGGGCAAAAGATCACCGAGTGTCCGCCAATCATT AGAACCGTGTTTCTTTTCATACTCCAGATATTTAAACCCTGACGAAAGTCCCTTCCCCAT GTCTTTCAAACAATCGGAGTACATCTGTTTGGCTACACCAGAGGCACTGTGATACACTTT GTTCGATCCGCTCGGATATTCAATGAAAATTTTCAATTCATAATCCATACCTGGTTTGTA GGTAGCATCAAATGAAAACACACGACCTCTCCGGGTGTGATCTTTCTTGAATCTTACCTC AAACGGGGTGCAGTTGGAAAGTGTTGCCAGTGTTTGACGAACAAGTCCCGGGCGC3’
Discussion and Conclusion
These 3 interferons are, in a general way, found in vertebrates. In mouse, IFIH1 encodes a cytoplasmic viral RNA receptor that activates type I interferon [4]: it implicates antiviral immunity. We suppose it plays the same role in sea star. IFRD1 gene, in mouse is expressed mostly in neutrophils skeletal and cardiac muscle (inducer of muscle regeneration). In sea star its role remains enigmatic. At last, I2BPL gene, in mouse, encodes a transcription factor that may play a role in regulating female reproductive function. Its function, in sea star holds of the mystery. In conclusion six IFR genes have been described in an Invertebrate: the sea star Asterias rubens, when compared to mouse genome: they concern adaptative and innate immunity.
Bibliography
  1. Leclerc M. Cellular Immunology and Immunotherapeutics. In press (2016).
  2. Xu QQ., et al. Zoology Research 35.5 (2014): 380-388.
  3. Leclerc M., et al. Immunology Letters 151 (2013): 68-70.
  4. Zerbino DR., et al. Genetic Research 18 (2007): 821-829.
  5. Rice GI., et al. Nature Genetics 46 (2014): 503-509.
Copyright: © 2016 Michel Leclerc and Nicolas Kresdorn. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

PubMed Indexed Article

EC Pharmacology and Toxicology
LC-UV-MS and MS/MS Characterize Glutathione Reactivity with Different Isomers (2,2' and 2,4' vs. 4,4') of Methylene Diphenyl-Diisocyanate.

PMID: 31143884 [PubMed]

PMCID: PMC6536005


EC Pharmacology and Toxicology
Alzheimer's Pathogenesis, Metal-Mediated Redox Stress, and Potential Nanotheranostics.

PMID: 31565701 [PubMed]

PMCID: PMC6764777


EC Neurology
Differences in Rate of Cognitive Decline and Caregiver Burden between Alzheimer's Disease and Vascular Dementia: a Retrospective Study.

PMID: 27747317 [PubMed]

PMCID: PMC5065347


EC Pharmacology and Toxicology
Will Blockchain Technology Transform Healthcare and Biomedical Sciences?

PMID: 31460519 [PubMed]

PMCID: PMC6711478


EC Pharmacology and Toxicology
Is it a Prime Time for AI-powered Virtual Drug Screening?

PMID: 30215059 [PubMed]

PMCID: PMC6133253


EC Psychology and Psychiatry
Analysis of Evidence for the Combination of Pro-dopamine Regulator (KB220PAM) and Naltrexone to Prevent Opioid Use Disorder Relapse.

PMID: 30417173 [PubMed]

PMCID: PMC6226033


EC Anaesthesia
Arrest Under Anesthesia - What was the Culprit? A Case Report.

PMID: 30264037 [PubMed]

PMCID: PMC6155992


EC Orthopaedics
Distraction Implantation. A New Technique in Total Joint Arthroplasty and Direct Skeletal Attachment.

PMID: 30198026 [PubMed]

PMCID: PMC6124505


EC Pulmonology and Respiratory Medicine
Prevalence and factors associated with self-reported chronic obstructive pulmonary disease among adults aged 40-79: the National Health and Nutrition Examination Survey (NHANES) 2007-2012.

PMID: 30294723 [PubMed]

PMCID: PMC6169793


EC Dental Science
Important Dental Fiber-Reinforced Composite Molding Compound Breakthroughs

PMID: 29285526 [PubMed]

PMCID: PMC5743211


EC Microbiology
Prevalence of Intestinal Parasites Among HIV Infected and HIV Uninfected Patients Treated at the 1o De Maio Health Centre in Maputo, Mozambique

PMID: 29911204 [PubMed]

PMCID: PMC5999047


EC Microbiology
Macrophages and the Viral Dissemination Super Highway

PMID: 26949751 [PubMed]

PMCID: PMC4774560


EC Microbiology
The Microbiome, Antibiotics, and Health of the Pediatric Population.

PMID: 27390782 [PubMed]

PMCID: PMC4933318


EC Microbiology
Reactive Oxygen Species in HIV Infection

PMID: 28580453 [PubMed]

PMCID: PMC5450819


EC Microbiology
A Review of the CD4 T Cell Contribution to Lung Infection, Inflammation and Repair with a Focus on Wheeze and Asthma in the Pediatric Population

PMID: 26280024 [PubMed]

PMCID: PMC4533840


EC Neurology
Identifying Key Symptoms Differentiating Myalgic Encephalomyelitis and Chronic Fatigue Syndrome from Multiple Sclerosis

PMID: 28066845 [PubMed]

PMCID: PMC5214344


EC Pharmacology and Toxicology
Paradigm Shift is the Normal State of Pharmacology

PMID: 28936490 [PubMed]

PMCID: PMC5604476


EC Neurology
Examining those Meeting IOM Criteria Versus IOM Plus Fibromyalgia

PMID: 28713879 [PubMed]

PMCID: PMC5510658


EC Neurology
Unilateral Frontosphenoid Craniosynostosis: Case Report and a Review of the Literature

PMID: 28133641 [PubMed]

PMCID: PMC5267489


EC Ophthalmology
OCT-Angiography for Non-Invasive Monitoring of Neuronal and Vascular Structure in Mouse Retina: Implication for Characterization of Retinal Neurovascular Coupling

PMID: 29333536 [PubMed]

PMCID: PMC5766278


EC Neurology
Longer Duration of Downslope Treadmill Walking Induces Depression of H-Reflexes Measured during Standing and Walking.

PMID: 31032493 [PubMed]

PMCID: PMC6483108


EC Microbiology
Onchocerciasis in Mozambique: An Unknown Condition for Health Professionals.

PMID: 30957099 [PubMed]

PMCID: PMC6448571


EC Nutrition
Food Insecurity among Households with and without Podoconiosis in East and West Gojjam, Ethiopia.

PMID: 30101228 [PubMed]

PMCID: PMC6086333


EC Ophthalmology
REVIEW. +2 to +3 D. Reading Glasses to Prevent Myopia.

PMID: 31080964 [PubMed]

PMCID: PMC6508883


EC Gynaecology
Biomechanical Mapping of the Female Pelvic Floor: Uterine Prolapse Versus Normal Conditions.

PMID: 31093608 [PubMed]

PMCID: PMC6513001


EC Dental Science
Fiber-Reinforced Composites: A Breakthrough in Practical Clinical Applications with Advanced Wear Resistance for Dental Materials.

PMID: 31552397 [PubMed]

PMCID: PMC6758937


EC Microbiology
Neurocysticercosis in Child Bearing Women: An Overlooked Condition in Mozambique and a Potentially Missed Diagnosis in Women Presenting with Eclampsia.

PMID: 31681909 [PubMed]

PMCID: PMC6824723


EC Microbiology
Molecular Detection of Leptospira spp. in Rodents Trapped in the Mozambique Island City, Nampula Province, Mozambique.

PMID: 31681910 [PubMed]

PMCID: PMC6824726


EC Neurology
Endoplasmic Reticulum-Mitochondrial Cross-Talk in Neurodegenerative and Eye Diseases.

PMID: 31528859 [PubMed]

PMCID: PMC6746603


EC Psychology and Psychiatry
Can Chronic Consumption of Caffeine by Increasing D2/D3 Receptors Offer Benefit to Carriers of the DRD2 A1 Allele in Cocaine Abuse?

PMID: 31276119 [PubMed]

PMCID: PMC6604646


EC Anaesthesia
Real Time Locating Systems and sustainability of Perioperative Efficiency of Anesthesiologists.

PMID: 31406965 [PubMed]

PMCID: PMC6690616


EC Pharmacology and Toxicology
A Pilot STEM Curriculum Designed to Teach High School Students Concepts in Biochemical Engineering and Pharmacology.

PMID: 31517314 [PubMed]

PMCID: PMC6741290


EC Pharmacology and Toxicology
Toxic Mechanisms Underlying Motor Activity Changes Induced by a Mixture of Lead, Arsenic and Manganese.

PMID: 31633124 [PubMed]

PMCID: PMC6800226


EC Neurology
Research Volunteers' Attitudes Toward Chronic Fatigue Syndrome and Myalgic Encephalomyelitis.

PMID: 29662969 [PubMed]

PMCID: PMC5898812


EC Pharmacology and Toxicology
Hyperbaric Oxygen Therapy for Alzheimer's Disease.

PMID: 30215058 [PubMed]

PMCID: PMC6133268


News and Events

June Issue Release

We always feel pleasure to share our updates with you all. Here, notifying you that we have successfully released the June issue of respective journals and the latest articles can be viewed on the current issue pages.

Submission Deadline for Upcoming Issue

ECronicon delightfully welcomes all the authors around the globe for effective collaboration with an article submission for the upcoming issue of respective journals. Submissions are accepted on/before July 12, 2022.

Certificate of Publication

ECronicon honors with a "Publication Certificate" to the corresponding author by including the names of co-authors as a token of appreciation for publishing the work with our respective journals.

Best Article of the Issue

Editors of respective journals will always be very much interested in electing one Best Article after each issue release. The authors of the selected article will be honored with a "Best Article of the Issue" certificate.

Certifying for Review

ECronicon certifies the Editors for their first review done towards the assigned article of the respective journals.

Latest Articles

The latest articles will be updated immediately on the articles in press page of the respective journals.