Welcoming you for any type of article submission for the upcoming issue on/before February 26, 2021.


Short Communication
Volume 2 Issue 4 - 2016
The Asterias Rubens Toll-Like Receptors (Tlr): Genomic Studies
Michel Leclerc* and Nicolas Kresdorn2
1Orleans Cell Biology, Developmental Biology and Immunology, University of Orleans, France
2Department Plant Breeding and Genetics, GenXpro, Frankfurt, Germany
*Corresponding Author: Michel L, Department of Genxpro, 556 rue Isabelle Romée 45640 Sandillon, France.
Received: March 13, 2016; Published: May 02, 2016
Citation: Michel Leclerc and Nicolas Kresdorn. “The Asterias Rubens Toll-Like Receptors (Tlr):Genomic Studiess”. EC Bacteriology and Virology 2.4 (2016) : 129-130.
Abstract
Sea star TLR receptors were described in the present paper. Most of them correspond to mouse TLR in their genome. Two other ones were found in Drosophila melanogaster and its genome.
Keywords: Asterias Rubens; Toll-Like Receptors; DROME; TLR network
Introduction
At the end of the 20 th century, Toll also named Drome was shown to be an essential receptor for host defense against fungal infection in Drosophila melanogaster which only has innate immunity.
Later a mammalian homolog of the Toll receptor (now named TLR4) was discovered to induce expression of genes involved in inflammatory response.
Further more, activation of innate immunity is a critical step to the development of adaptative immunity which has been described in mammals and also in sea star immune system [1].
The aim of the present work, is to report genomic studies concerning TLR in immunized and non-immunized sea stars to HRP.
Materials and Methods
Sea stars were obtained from the Biology Institute (Gothenbugh University). Immunizations, genomic studies were already described [2]. After ligation of adapters for Illumina’s GSII sequencing system, the cDNA was sequenced on the Illumina GSII platform sequencing. 1.100 bp from one side of the approximately 200 bp fragments sequences were assembled using Velvet [3].
Results
First results concern significative TLR genes found in control sea stars (a) and immunized sea stars (HRP) (b and c) as compared to Drosophila melanogaster genome :
Control
Contig13262 582 tr|Q2XXW0|Q2XXW0_DROME CG6890 (Fragment) OS=Drosophila melanogaster GN=Tollo PE=4 SV=1
Immunized sea stars to HRP
Contig3456|m.6143 1127 tr|Q2XXW0|Q2XXW0_DROME CG6890 (Fragment) OS=Drosophila melanogaster GN=Tollo PE=4 SV=1
Contig17904|m.13098 711 tr|M9NDW9|M9NDW9_DROME Toll-9, isoform B OS=Drosophila melanogaster GN=Toll-9 PE=4 SV=1
DROME Toll-9 isoform B in immunized sea star (sequence)
One contig (Contig17904|m.13098) could be annotvated via BLASTX to Drosophila melanogaster “Toll-9, isoform B” from the Trembl database (M9NDW9_DROME), with an (e-value of 3.98e-25. On an aligned region of 204 aminoacids, 109 positive and 68 identical amino acids were found.
5’GGATTTCAACCCCGAAGTTTTGAACTGTGATGGAAAGATTCCGCTGCAGTATTGGATCAT AATTGGTGTTGGAAACTTTGTGATCCTCGTTTTAATCATTGCTTTGATATATAATCGCTG GAAGATTTACTATGTCTACTTGTTGGTGAAGGCGCGCCATCATCGGGCAAGAAAAGACGA GTATGACAGATTGAATGATTACAGGTTCGATGCCTTCATATCTCACAGCAGCGCTGACGA GGATTGGGTCAAAGATAAACTGTTACCTGAGCTAGAGAATGGAGAGAATCCATTCAAAGT CTGCCATCACGAGCGTGATTTTGAACCTGGGCAAGAGATCATTGACAACATCATTGATTC CGTCGACCACAGCAGACGCACCATCTGTGTCATATCGAAGAGCTACCTGGAGAGCAACTG GTGCACCTACGAGAGACGGGTCACCATGAGTAAATTATTCATCAACTACAAAGATGTCCT GGTTCTGATCATCTTGGAAGATATTCCAGATAAGAAGATGTCCAAGTATGATCTCATCCA CCGGGCAGTCAAGAAGAACACGTACCTGAAGTGGCCGGGAGAGGATGGAAGAGCTGATGA GAAGGCTGTTTTCTGGCAACGCCTGAAGACAGTCTTGGGTGAAGATCGTACACCGGAAAA TAATGAGGAGCTTGCTTAAAGGCACTTGCTTAAAGGCACTGGACACTGTTG3’
Sea star TLR receptor genes when compared to mouse TLR ones :
Immunized and non-immunized sea stars and Mouse share in common :
TLR1 toll-like receptor 1, TLR4 toll-like receptor4, TLR3 toll-like receptor 3,TLR5 toll-like receptor5, TLR7 toll-like receptor 7, TLR9 toll-like receptor 9, TLR12 toll-like receptor 12, TLR13 toll-like receptor 13.
Discussion
It seems now obvious that the recognition of microbial components by TLRs initiates signal transduction pathways which triggers expression of genes. These gene products , in Asterias rubens, control innate immune responses and further instuct development of antigen-specific adaptative immunity which induces the production of the « invertebrate primitive antibody »[1].
On the other hand, the presence of TLR9 (Toll-9 isoform B in Drosophila) , indicates that it mediates induction of NF Kappa-B in human [4] and may be in sea star. We recall the discovery of NF Kappa-B genes in sea star [5].
Conclusion
The TLR network in Asterias rubens sea star seems complete when compared to mouse one.
Bibliography
  1. Leclerc M., et al. “Immune Properties Corroborated by A. Rubens Sea Star Igkappa Gene”. Scholarena Journal (SAJ) of Biotechnology (2014): 1-104.
  2. Leclerc M., et al. “Evidence of complement genes in the sea-star Asterias rubens. Comparisons with the sea urchin”. Immunology Letters 151 (2013): 68-70.
  3. Zerbino DR., et al. “Velvet: Algorithms for de novo short read assembly using de Bruijn graphss”. Gen. Res 18 (2007): 821-829.
  4. Sandholm J., et al. “Estrogen receptor-α and sex steroid hormones regulate Toll-like receptor-9 expression and invasive function in human breast cancer cells”. Breast Cancer Research and Treatment 132. 2 (2012): 411-419.
  5. Leclerc M., et al. “Asterias rubens: Evidence of NF-kappa B genes”. Meta Gene 8 (2016): 30-32.
Copyright: © 2016 Michel Leclerc and Nicolas Kresdorn. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

PubMed Indexed Article

EC Pharmacology and Toxicology
LC-UV-MS and MS/MS Characterize Glutathione Reactivity with Different Isomers (2,2' and 2,4' vs. 4,4') of Methylene Diphenyl-Diisocyanate.

PMID: 31143884 [PubMed]

PMCID: PMC6536005


EC Pharmacology and Toxicology
Alzheimer's Pathogenesis, Metal-Mediated Redox Stress, and Potential Nanotheranostics.

PMID: 31565701 [PubMed]

PMCID: PMC6764777


EC Neurology
Differences in Rate of Cognitive Decline and Caregiver Burden between Alzheimer's Disease and Vascular Dementia: a Retrospective Study.

PMID: 27747317 [PubMed]

PMCID: PMC5065347


EC Pharmacology and Toxicology
Will Blockchain Technology Transform Healthcare and Biomedical Sciences?

PMID: 31460519 [PubMed]

PMCID: PMC6711478


EC Pharmacology and Toxicology
Is it a Prime Time for AI-powered Virtual Drug Screening?

PMID: 30215059 [PubMed]

PMCID: PMC6133253


EC Psychology and Psychiatry
Analysis of Evidence for the Combination of Pro-dopamine Regulator (KB220PAM) and Naltrexone to Prevent Opioid Use Disorder Relapse.

PMID: 30417173 [PubMed]

PMCID: PMC6226033


EC Anaesthesia
Arrest Under Anesthesia - What was the Culprit? A Case Report.

PMID: 30264037 [PubMed]

PMCID: PMC6155992


EC Orthopaedics
Distraction Implantation. A New Technique in Total Joint Arthroplasty and Direct Skeletal Attachment.

PMID: 30198026 [PubMed]

PMCID: PMC6124505


EC Pulmonology and Respiratory Medicine
Prevalence and factors associated with self-reported chronic obstructive pulmonary disease among adults aged 40-79: the National Health and Nutrition Examination Survey (NHANES) 2007-2012.

PMID: 30294723 [PubMed]

PMCID: PMC6169793


EC Dental Science
Important Dental Fiber-Reinforced Composite Molding Compound Breakthroughs

PMID: 29285526 [PubMed]

PMCID: PMC5743211


EC Microbiology
Prevalence of Intestinal Parasites Among HIV Infected and HIV Uninfected Patients Treated at the 1o De Maio Health Centre in Maputo, Mozambique

PMID: 29911204 [PubMed]

PMCID: PMC5999047


EC Microbiology
Macrophages and the Viral Dissemination Super Highway

PMID: 26949751 [PubMed]

PMCID: PMC4774560


EC Microbiology
The Microbiome, Antibiotics, and Health of the Pediatric Population.

PMID: 27390782 [PubMed]

PMCID: PMC4933318


EC Microbiology
Reactive Oxygen Species in HIV Infection

PMID: 28580453 [PubMed]

PMCID: PMC5450819


EC Microbiology
A Review of the CD4 T Cell Contribution to Lung Infection, Inflammation and Repair with a Focus on Wheeze and Asthma in the Pediatric Population

PMID: 26280024 [PubMed]

PMCID: PMC4533840


EC Neurology
Identifying Key Symptoms Differentiating Myalgic Encephalomyelitis and Chronic Fatigue Syndrome from Multiple Sclerosis

PMID: 28066845 [PubMed]

PMCID: PMC5214344


EC Pharmacology and Toxicology
Paradigm Shift is the Normal State of Pharmacology

PMID: 28936490 [PubMed]

PMCID: PMC5604476


EC Neurology
Examining those Meeting IOM Criteria Versus IOM Plus Fibromyalgia

PMID: 28713879 [PubMed]

PMCID: PMC5510658


EC Neurology
Unilateral Frontosphenoid Craniosynostosis: Case Report and a Review of the Literature

PMID: 28133641 [PubMed]

PMCID: PMC5267489


EC Ophthalmology
OCT-Angiography for Non-Invasive Monitoring of Neuronal and Vascular Structure in Mouse Retina: Implication for Characterization of Retinal Neurovascular Coupling

PMID: 29333536 [PubMed]

PMCID: PMC5766278


EC Neurology
Longer Duration of Downslope Treadmill Walking Induces Depression of H-Reflexes Measured during Standing and Walking.

PMID: 31032493 [PubMed]

PMCID: PMC6483108


EC Microbiology
Onchocerciasis in Mozambique: An Unknown Condition for Health Professionals.

PMID: 30957099 [PubMed]

PMCID: PMC6448571


EC Nutrition
Food Insecurity among Households with and without Podoconiosis in East and West Gojjam, Ethiopia.

PMID: 30101228 [PubMed]

PMCID: PMC6086333


EC Ophthalmology
REVIEW. +2 to +3 D. Reading Glasses to Prevent Myopia.

PMID: 31080964 [PubMed]

PMCID: PMC6508883


EC Gynaecology
Biomechanical Mapping of the Female Pelvic Floor: Uterine Prolapse Versus Normal Conditions.

PMID: 31093608 [PubMed]

PMCID: PMC6513001


EC Dental Science
Fiber-Reinforced Composites: A Breakthrough in Practical Clinical Applications with Advanced Wear Resistance for Dental Materials.

PMID: 31552397 [PubMed]

PMCID: PMC6758937


EC Microbiology
Neurocysticercosis in Child Bearing Women: An Overlooked Condition in Mozambique and a Potentially Missed Diagnosis in Women Presenting with Eclampsia.

PMID: 31681909 [PubMed]

PMCID: PMC6824723


EC Microbiology
Molecular Detection of Leptospira spp. in Rodents Trapped in the Mozambique Island City, Nampula Province, Mozambique.

PMID: 31681910 [PubMed]

PMCID: PMC6824726


EC Neurology
Endoplasmic Reticulum-Mitochondrial Cross-Talk in Neurodegenerative and Eye Diseases.

PMID: 31528859 [PubMed]

PMCID: PMC6746603


EC Psychology and Psychiatry
Can Chronic Consumption of Caffeine by Increasing D2/D3 Receptors Offer Benefit to Carriers of the DRD2 A1 Allele in Cocaine Abuse?

PMID: 31276119 [PubMed]

PMCID: PMC6604646


EC Anaesthesia
Real Time Locating Systems and sustainability of Perioperative Efficiency of Anesthesiologists.

PMID: 31406965 [PubMed]

PMCID: PMC6690616


EC Pharmacology and Toxicology
A Pilot STEM Curriculum Designed to Teach High School Students Concepts in Biochemical Engineering and Pharmacology.

PMID: 31517314 [PubMed]

PMCID: PMC6741290


EC Pharmacology and Toxicology
Toxic Mechanisms Underlying Motor Activity Changes Induced by a Mixture of Lead, Arsenic and Manganese.

PMID: 31633124 [PubMed]

PMCID: PMC6800226


EC Neurology
Research Volunteers' Attitudes Toward Chronic Fatigue Syndrome and Myalgic Encephalomyelitis.

PMID: 29662969 [PubMed]

PMCID: PMC5898812


EC Pharmacology and Toxicology
Hyperbaric Oxygen Therapy for Alzheimer's Disease.

PMID: 30215058 [PubMed]

PMCID: PMC6133268


News and Events

November Issue Release

We always feel pleasure to share our updates with you all. Here, notifying you that we have successfully released the November issue of respective journals and the latest articles can be viewed on the current issue pages.

Submission Deadline for Upcoming Issue

ECronicon delightfully welcomes all the authors around the globe for effective collaboration with an article submission for the upcoming issue of respective journals. Submissions are accepted on/before December 15, 2022.

Certificate of Publication

ECronicon honors with a "Publication Certificate" to the corresponding author by including the names of co-authors as a token of appreciation for publishing the work with our respective journals.

Best Article of the Issue

Editors of respective journals will always be very much interested in electing one Best Article after each issue release. The authors of the selected article will be honored with a "Best Article of the Issue" certificate.

Certifying for Review

ECronicon certifies the Editors for their first review done towards the assigned article of the respective journals.

Latest Articles

The latest articles will be updated immediately on the articles in press page of the respective journals.