Welcoming you for any type of article submission for the upcoming issue on/before February 26, 2021.


Short Communication
Volume 2 Issue 2 - 2016
The Il2’S Problem, Il4 Evidence in Asterias Rubens Sea Star
Michel Leclerc1* and Nicolas Kresdorn2
1556 Rue Isabelle Rome 45640 Sandillon, France
2GenXPro, Frankfurt, Germany
*Corresponding Author: Michel Leclerc, 556 Rue Isabelle Rome, 45640 Sandillon, France.
Received: February 23, 2016; Published: April 07, 2016
Citation: Michel Leclerc and Nicolas Kresdorn. “The Il2’S Problem, Il4 Evidence in Asterias Rubens Sea Star”. EC Bacteriology and Virology Research 2.2 (2016): 74-76.
Abstract
IL2-like activity was described in sea star, in the past but first sea star genome studies did not confirm the presence of IL2 in A. Rubens. A new genomic survey of Interleukins: IL2 and IL4 were done, in this invertebrate
Keywords: Immune receptors; Interleukin; Transcription
Introduction
Echinoderms occupy a critical and largely unexplored phylogenetic vantage point from which to infer both the early evolution of bilaterian immunity and the underpinnings of the invertebrate innate and its adaptative immunity. Here, we present a survey of the Asterias Rubens sea star genome for genes associated with immunity. In a preliminary work [1] IL1 and IL1R were detected but not IL2, IL4. Our purpose was to research potential interleukins: IL2, IL4 immune receptors, regulators and effectors, particularly, including unprecedented expansions of innate pathogen recognition genes.
Materials and Methods
Immunized and non-immunized A. Rubens sea stars to HRP (Horse-radish peroxydase) were used. Their axial organs were removed. RNA was extracted using Trizol (Invitrogen) according to manufacturer instructions. Following steps were already described [1], the cDNA was sequenced on the illumina GSII platform sequencing 1. 100 bp from one side of the approximately 200 bp fragments. Sequences were assembled using Velvet [2].
Results
Immunized sea star genome shows a first result in the Table 1

1) tr|B2RBI8|B2RBI8_HUMAN cDNA, FLJ95535, highly similar to Homo sapiens transcription factor 8
(represses interleukin 2 expression) (TCF8), mRNA, OS = Homo sapiens PE = 2, SV = 1.
2) tr|A2RRH1|A2RRH1_HUMAN Interleukin 4 induced 1 OS = Homo sapiens GN = IL4I1, PE = 2, SV = 1

Table 1: Sea star similarities to human tcf 8 (1), to IL4 induced 1 (2).
One contig (Contig 12015|m.10216) could be annotated via BLASTX to Homo sapiens “cDNA, FLJ95535, highly similar to Homo sapiens transcription factor 8 (represses interleukin 2 expression) (TCF8), mRNA” from the TREMBL database, with an e-value of 3e-40. On an aligned region of 96 amino acids, 79 positive and 71 identical amino acids were found.

5'GGAGGATTCACTGGGTGAACTCTCCCCAAACCGCGACCGCAGGAGACGAGATCGTCCTCT ACGTACCTCTGCTGGACTCTACTCATGCACCCAGTGCCCCAAGACATTCCAGAAGCACAG CTCCCTGCTCAGACACGTGTACGAGCACTCAGGTGAGCCAAAAAGTAAGCGTCCACACGA GTGTAAGGAGTGCGGCAAGGCCTTTAAGCACAAGCACCACCTCATGGAGCACGCGCGTCT TCATAGTGGTGAGAAGCCATACCAGTGTGACAAGTGCCTTAAGAAGTTCTCTCACTCCGG CTCCTACAGCCAGCACATGAACCATCGCTACAGCTACTGCCGTAAAGAGGACAATCTCAA CAGGGGGATGAGCAAAGGTGGTATGGATGAAGATGAGGAGATGATGGAAGATGGAGAACT TGAAAGATGTAAGCAGAGTGGG3'

Figure 1: Stcf 8 sequence (5’-3’).

Another contig allows us to report the IL4 obtained sequence in immunized sea stars to HRP One contig (Contig10756|m.9341) could be annotated via BLASTX to Homo sapiens “Interleukin 4 induced 1” from the TREMBL database, with an e-value of 2.28e-16. On an aligned region of 453 amino acids, 187 positive and 105 identical amino acids were found.

5'TCTGGTTGTTGAGGCTCGAGATCGTCTCGGAGGTCGAACCCACACTCTGGTGGACCCCTC CATTGGTTATGTGGATTTGGGCGGAGCTTACGTCGGCCCCACCCAGAATCGTCTTCTCCG TATGGCCAAGGAACTGGGCGTGGAAAACTACAAGATCAACGAAGCTGAGAGGCTTGTTTG GGTTGATAATCAACGTGGTTACCCTTTCAAGGGATCATGGCCCAAGTTCTGGAACCCTCT CGTCAATCTGGATTTGAATAACGCTATCCGAGAGATCGACAGACTTGGAGATATGATTTC AGTGGATGCACCTTGGGACGCACCAAATGCCGAAGAGCTGGATAACATGACGATGAAAGA ATGGATCGACAAGACATGTTGGACAGAAAGCATCCGCCGTCTTTTTATTACAACTTGTGA GGTTGGCGTTTGCATGGAACCCCAAGAGCTATCGGTCCTCTTCTTCGCGTGGTATCTGAA ACAGACAGGTGGATACGTTCGATTTATATCGAGTGATAATGGCGGCCAGGAGCGGAAGTT TGTTGGTGGATCTCAGCAGATAAGCATTAAGATGGGAGAGAAGATCGGCAAAGAGAACAT CAAGATGGAGAGTCCAGTAGCTCAGATTAATCAGAGTGAGGAGTCTGTTTCTGTGCACAC CATCAACGGAGATGTCTATCAGGCTAAGTACGTGATCAGCGCAATGGCCCCACCTTTGAC CCAGAAGATTCACTATGACCCGCCCCTGCCTCCTAGGAGAAACCAGCTGATATCCAGAGC CCCTGTAGGCAGTGTCATCAAGTGCATGGTGTACTACGACAAGACATGGTGGAAAGATAG AGATTTTTGTGGCTCCACCTTCAACGTTGACCCAGCAAGTCCGATGGTGTATTCACTTGA TGACACAAAACCTGATGGCAGTCACCCAGCCCTTATCTGTTTTGTGGCTGCTAACAAGGC CAGAGAGTTCTGCGGGATCAGCAAAGAGGAAAGACGAGACAGGCTGTGCAGATGTTACAG TGCTGCCTTCGGTGGAGCAGAGGAAGCCTTACACCCTATCAACTACAAGGAGAAGAACTG GATGAATGAGCAGTACTCCGGTGGCTGCTACACCTCTACCTATGGCCCTGGTGTTCTGAC TCAACTTGGAAAAGAGCTCCGTAAACCATTTGGCAGATTGTATTTTGCTGGGACTGAAAC TGCGACACACTGGGCTGGCTACATGGAAGGAGCTATACAGGCTGGAGAGAGAGCTGCTAG GGAGATTCAGCACAGAATGGGAAAGATTGACGAGAATGAAATCTGGCAGGATGAACCAGA ATCAAAGGAGGTGCCAGCCCTTCCGATACCGACCACCTTCTACGAACGCAACGCTCCATC TGTACCTGGCTTGTTTAAATTCATTGGTCGTACTGTTGTCTTGTCTGCTGTTATCGGAGT CTTCGCGATCTGCCGCCTGAAGAAAAAATAAACCACATCGATCGACGAGCCGAGACAAAC CAACTCCTGAAGATATTCCTGAGTGAGCCAAACTCCATTCATAGAAAAATTATTCAATTT AATGCGATTCATTGAGAGATTTATTTCAAGATATTGTCTTTGAGAAAGAAAAAAATACTG TCAATATAAACAAATGTGGAGGCGCGTTCAAACAAGCAGAGTTTGTCAAGAAACGTCCTA CAAAAAAACCGAAACAAAACCACAAGTTTACAAAGGTAAAAAAATAAACAAAATAATTGA TTATATTGCATGACTTTAATCATGTGATGTGGTTGAATGCCGGCAGAGTTACTATTTTAT TTTATTAATTTGGTGTTTAGGGTTCTATTAGTTTTTGGTTTAGTAGCATTTGTTTCTTTA GGTAAGTGGCAACAATTTCAAATTAATACTGCGATCCCAGTTTCCATAAACAAAGTGTTT CAATGAACTAACCCCTAGGGCTCAGTTTCATGGAACTGCTTAAGCATAAAAAGTTGCTAA GCACAGACAAATTATGCTAACCCGATTAACGTTACCAGCTAAAATACAGCTATACATGTA CACAATGTAAATGGTATCCTGCTTAAATGTGCTTAGCGGGAAAATTTCTGCTTGCCACTT GTGTGATAACTAGTGATATATCACAAAACTGTTATCTTGTTTATTGAATAGCTCGCCTTG TACATGTAGGACCTTTTCTTTTTTTCTTGCTGGACGTATGAAAGTCAATTAATCCTTAAA AAAGGAAACTGAAGTAATGGAAAGAAAGTCAAGATTTGTGTGAAGTTGCAGTGGAAGCTG TCAAAGTTTCCTCTGAAGAATGATTCTGTTTGAAATAAGATGGTCACTTTGTGGATGACT GTATGAGGCGCCATAAATATGCCTTTTTTAAATAATAATAATAATTATTTTTGTAGGTTT TATTATTATCACATTAGTTTGAATGGTGACTTTGAAGTACACACTGAA3'

Figure 2: Sequence of IL4 induced 1.

Discussion
We have learnt that sea star T lymphocytes can release soluble lymphokin mediators, after stimulation with P.W.M (Pokeweed mitogen) sepharose 6 MB beads with mitogenic properties [3]. IL2-like was discovered in Legac., et al. [4], using flow cytometric discrimination, but first genomic studies [1] didn’t corroborate this cytometric result. So, recently, we took back genomic works. We mainly found TCF8, which represses interleukin 2 expressions in man, but what did it do in sea star? Is it an indirect evidence of IL2 in Asterias Rubens? It remains enigmatic. We also found IL4 in immunized sea stars only. IL4 induced 1: an interleukin induced by B lymphocytes and why not by sea star B lymphocytes? [1]. The possible absence of true IL2 may reflect the difficulties of identifying these rapidly evolving genes, which have slow protein domain complexity and complex intron - exon structure. Nevertheless, members of most cytokine and chemokine families and their receptors were detected in the sea star genome.
Conclusion
In conclusion, our data are consistent with the hypothesis that a true cytokine network exists in Asterias Rubens genome.
Bibliography
  1. Leclerc M. “Innate and Adaptative Immunity in the Sea-Star Asterias Rubens”. American Journal of Immunology 8.3 (2012): 78-83.
  2. Zerbino DR and E Birney. “Velvet: algorithms for de novo short read assembly using de Bruijn graphs”. Genome Research 18.5 (2008): 821-829.
  3. Leclerc MC., et al. “Properties of Cell Subpopulations of Starfish Axial Organ: In Vitro Effect of Pokeweed Mitogen and Evi dence of Lymphokine-like Substances”. Scandinavian Journal of Immunology 14.3 (1981): 281-284.
  4. Legac E., et al. “Primitive Cytokines and Cytokine Receptors in Invertebrates: the Sea Star Asterias rubens as a Model of Study”. Scandinavian Journal of Immunology 44.4 (1996): 375-380.
Copyright: © 2016 Michel Leclerc and Nicolas Kresdorn. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

PubMed Indexed Article

EC Pharmacology and Toxicology
LC-UV-MS and MS/MS Characterize Glutathione Reactivity with Different Isomers (2,2' and 2,4' vs. 4,4') of Methylene Diphenyl-Diisocyanate.

PMID: 31143884 [PubMed]

PMCID: PMC6536005


EC Pharmacology and Toxicology
Alzheimer's Pathogenesis, Metal-Mediated Redox Stress, and Potential Nanotheranostics.

PMID: 31565701 [PubMed]

PMCID: PMC6764777


EC Neurology
Differences in Rate of Cognitive Decline and Caregiver Burden between Alzheimer's Disease and Vascular Dementia: a Retrospective Study.

PMID: 27747317 [PubMed]

PMCID: PMC5065347


EC Pharmacology and Toxicology
Will Blockchain Technology Transform Healthcare and Biomedical Sciences?

PMID: 31460519 [PubMed]

PMCID: PMC6711478


EC Pharmacology and Toxicology
Is it a Prime Time for AI-powered Virtual Drug Screening?

PMID: 30215059 [PubMed]

PMCID: PMC6133253


EC Psychology and Psychiatry
Analysis of Evidence for the Combination of Pro-dopamine Regulator (KB220PAM) and Naltrexone to Prevent Opioid Use Disorder Relapse.

PMID: 30417173 [PubMed]

PMCID: PMC6226033


EC Anaesthesia
Arrest Under Anesthesia - What was the Culprit? A Case Report.

PMID: 30264037 [PubMed]

PMCID: PMC6155992


EC Orthopaedics
Distraction Implantation. A New Technique in Total Joint Arthroplasty and Direct Skeletal Attachment.

PMID: 30198026 [PubMed]

PMCID: PMC6124505


EC Pulmonology and Respiratory Medicine
Prevalence and factors associated with self-reported chronic obstructive pulmonary disease among adults aged 40-79: the National Health and Nutrition Examination Survey (NHANES) 2007-2012.

PMID: 30294723 [PubMed]

PMCID: PMC6169793


EC Dental Science
Important Dental Fiber-Reinforced Composite Molding Compound Breakthroughs

PMID: 29285526 [PubMed]

PMCID: PMC5743211


EC Microbiology
Prevalence of Intestinal Parasites Among HIV Infected and HIV Uninfected Patients Treated at the 1o De Maio Health Centre in Maputo, Mozambique

PMID: 29911204 [PubMed]

PMCID: PMC5999047


EC Microbiology
Macrophages and the Viral Dissemination Super Highway

PMID: 26949751 [PubMed]

PMCID: PMC4774560


EC Microbiology
The Microbiome, Antibiotics, and Health of the Pediatric Population.

PMID: 27390782 [PubMed]

PMCID: PMC4933318


EC Microbiology
Reactive Oxygen Species in HIV Infection

PMID: 28580453 [PubMed]

PMCID: PMC5450819


EC Microbiology
A Review of the CD4 T Cell Contribution to Lung Infection, Inflammation and Repair with a Focus on Wheeze and Asthma in the Pediatric Population

PMID: 26280024 [PubMed]

PMCID: PMC4533840


EC Neurology
Identifying Key Symptoms Differentiating Myalgic Encephalomyelitis and Chronic Fatigue Syndrome from Multiple Sclerosis

PMID: 28066845 [PubMed]

PMCID: PMC5214344


EC Pharmacology and Toxicology
Paradigm Shift is the Normal State of Pharmacology

PMID: 28936490 [PubMed]

PMCID: PMC5604476


EC Neurology
Examining those Meeting IOM Criteria Versus IOM Plus Fibromyalgia

PMID: 28713879 [PubMed]

PMCID: PMC5510658


EC Neurology
Unilateral Frontosphenoid Craniosynostosis: Case Report and a Review of the Literature

PMID: 28133641 [PubMed]

PMCID: PMC5267489


EC Ophthalmology
OCT-Angiography for Non-Invasive Monitoring of Neuronal and Vascular Structure in Mouse Retina: Implication for Characterization of Retinal Neurovascular Coupling

PMID: 29333536 [PubMed]

PMCID: PMC5766278


EC Neurology
Longer Duration of Downslope Treadmill Walking Induces Depression of H-Reflexes Measured during Standing and Walking.

PMID: 31032493 [PubMed]

PMCID: PMC6483108


EC Microbiology
Onchocerciasis in Mozambique: An Unknown Condition for Health Professionals.

PMID: 30957099 [PubMed]

PMCID: PMC6448571


EC Nutrition
Food Insecurity among Households with and without Podoconiosis in East and West Gojjam, Ethiopia.

PMID: 30101228 [PubMed]

PMCID: PMC6086333


EC Ophthalmology
REVIEW. +2 to +3 D. Reading Glasses to Prevent Myopia.

PMID: 31080964 [PubMed]

PMCID: PMC6508883


EC Gynaecology
Biomechanical Mapping of the Female Pelvic Floor: Uterine Prolapse Versus Normal Conditions.

PMID: 31093608 [PubMed]

PMCID: PMC6513001


EC Dental Science
Fiber-Reinforced Composites: A Breakthrough in Practical Clinical Applications with Advanced Wear Resistance for Dental Materials.

PMID: 31552397 [PubMed]

PMCID: PMC6758937


EC Microbiology
Neurocysticercosis in Child Bearing Women: An Overlooked Condition in Mozambique and a Potentially Missed Diagnosis in Women Presenting with Eclampsia.

PMID: 31681909 [PubMed]

PMCID: PMC6824723


EC Microbiology
Molecular Detection of Leptospira spp. in Rodents Trapped in the Mozambique Island City, Nampula Province, Mozambique.

PMID: 31681910 [PubMed]

PMCID: PMC6824726


EC Neurology
Endoplasmic Reticulum-Mitochondrial Cross-Talk in Neurodegenerative and Eye Diseases.

PMID: 31528859 [PubMed]

PMCID: PMC6746603


EC Psychology and Psychiatry
Can Chronic Consumption of Caffeine by Increasing D2/D3 Receptors Offer Benefit to Carriers of the DRD2 A1 Allele in Cocaine Abuse?

PMID: 31276119 [PubMed]

PMCID: PMC6604646


EC Anaesthesia
Real Time Locating Systems and sustainability of Perioperative Efficiency of Anesthesiologists.

PMID: 31406965 [PubMed]

PMCID: PMC6690616


EC Pharmacology and Toxicology
A Pilot STEM Curriculum Designed to Teach High School Students Concepts in Biochemical Engineering and Pharmacology.

PMID: 31517314 [PubMed]

PMCID: PMC6741290


EC Pharmacology and Toxicology
Toxic Mechanisms Underlying Motor Activity Changes Induced by a Mixture of Lead, Arsenic and Manganese.

PMID: 31633124 [PubMed]

PMCID: PMC6800226


EC Neurology
Research Volunteers' Attitudes Toward Chronic Fatigue Syndrome and Myalgic Encephalomyelitis.

PMID: 29662969 [PubMed]

PMCID: PMC5898812


EC Pharmacology and Toxicology
Hyperbaric Oxygen Therapy for Alzheimer's Disease.

PMID: 30215058 [PubMed]

PMCID: PMC6133268


News and Events

June Issue Release

We always feel pleasure to share our updates with you all. Here, notifying you that we have successfully released the June issue of respective journals and the latest articles can be viewed on the current issue pages.

Submission Deadline for Upcoming Issue

ECronicon delightfully welcomes all the authors around the globe for effective collaboration with an article submission for the upcoming issue of respective journals. Submissions are accepted on/before July 05, 2022.

Certificate of Publication

ECronicon honors with a "Publication Certificate" to the corresponding author by including the names of co-authors as a token of appreciation for publishing the work with our respective journals.

Best Article of the Issue

Editors of respective journals will always be very much interested in electing one Best Article after each issue release. The authors of the selected article will be honored with a "Best Article of the Issue" certificate.

Certifying for Review

ECronicon certifies the Editors for their first review done towards the assigned article of the respective journals.

Latest Articles

The latest articles will be updated immediately on the articles in press page of the respective journals.